Sample ID: VE25-1406_COI
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:03 |
| Analysis completed | 2025-05-03 01:28:03 |
| Wall time | 0:0:0 hours |
Pteromalidae sp.
Outcome: Positive species identification.
Reasoning: [Flag 1A] 1 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | False |
|
Flag 7B: Identified species is not consistent with preliminary morphology ID Muscidae. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
No GBIF record found for 'Pteromalidae sp.'. Taxonomic records cannot be retrieved for this species name - please check that this species name is correct.
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
| Taxa of interest detected? | False |
|
Flag 2B: Taxon of interest NOT detected in candidate species Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2C: ≤10% of taxon have reference sequence(s) at the given locus |
|
| Locus | COI |
| Preliminary ID | Muscidae |
| Taxa of interest |
Atherigona orientalis |
| Country | Vietnam |
| Host | Dragon Fruit |
| Sample ID | VE25-1406_COI |
| Query DNA sequence |
>VE25-1406_COI ATAAAGATATTGGTATTTTATATTTTATTTTTGGAATATGGTCAGGAATTATAGGAATAT CAATAAGAATAATTATTCGAATAGAATTAGGTAATCCAGGATCTTTAATTGGTAATGATC AAATTTATAATTCTATTGTTACAACTCATGCTTTTACAATAATTTTTTTTTTCGTTATAC CAGTAATAATAGGAGGATTTGGTAATTATTTTATTCCAATTATTTTAGGTATTCCCGATA TGGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCAAGATTAATATTAT TAATTAGAAGAATATTTATTAGTACAGGTACAGGTACAGGTTGGACTGTTTATCCACCAT TATCATTAAATTTATCTCATAATGGACCTTCAGTTGATTTATCAATTTTTTCTTTACATT TAGCAGGTGTTAGATCAATTATAGGATCAGTTAATTTTATTACTACTATTTTAAATATAA AAATTAATAAATATGAAAATATTCCTTTATTAGCTTGGGCTTTATTACTTACAGCTATTT TATTACTATTATCTTTACCTGTACTTGCTGGAGCAATTACTATACTATTATTTGATCGAA ATTTAAATACATCTTTTTTTGATCCTGCAGGAGGTGGAGATCCTGTTTTATATCAACATT TATTTTGATTTTT
Flag 1A:
Positive species identification
-
Pteromalidae sp.
1 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 1 | 1 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Pteromalidae sp. | 1 | 98.6% | 0.0 |
Database coverage of Candidate Pteromalidae sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Errors encountered:
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | OQ134363 | Pteromalidae sp. voucher D83 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 566 | 84.1% | 1059.02 | 0.00e+00 | 98.6% |
| 2 | OQ455486 | Pachycrepoideus vindemmiae voucher FZN 004 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 630 | 93.6% | 1138.31 | 0.00e+00 | 97.8% |
| 3 | OQ134362 | Pteromalidae sp. voucher D58 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 543 | 80.7% | 973.783 | 0.00e+00 | 97.6% |
| 4 | OM956372 | Pachycrepoideus vindemmiae isolate cytochrome oxidase subunit 1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 583 | 86.6% | 862.776 | 0.00e+00 | 93.7% |
| 5 | PP727399 | Pachycrepoideus vindemmiae strain hitman cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 944.049 | 0.00e+00 | 93.3% |
| 6 | MT712142 | Pachycrepoideus vindemmiae mitochondrion, partial genome | 673 | 100.0% | 922.244 | 0.00e+00 | 92.3% |
| 7 | MW441241 | Pachycrepoideus vindemmiae voucher PV-ETNA cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 626 | 93.0% | 844.936 | 0.00e+00 | 92.0% |
| 8 | MG500361 | Pteromalidae sp. BIOUG21831-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 463 | 68.8% | 545.614 | 3.13e-150 | 89.8% |
| 9 | KR901513 | Pteromalidae sp. BOLD-2016 voucher BIOUG07360-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 469 | 69.7% | 541.65 | 4.88e-149 | 89.6% |
| 10 | KR890598 | Pteromalidae sp. BOLD-2016 voucher BIOUG07358-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 462 | 68.6% | 527.774 | 7.34e-145 | 89.4% |
| 11 | KR879725 | Pteromalidae sp. BOLD-2016 voucher BIOUG07356-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 462 | 68.6% | 527.774 | 7.34e-145 | 89.4% |
| 12 | KR878700 | Pteromalidae sp. BOLD-2016 voucher BIOUG07389-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 462 | 68.6% | 527.774 | 7.34e-145 | 89.4% |
| 13 | KR885000 | Pteromalidae sp. BOLD-2016 voucher BIOUG07360-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 462 | 68.6% | 527.774 | 7.34e-145 | 89.4% |
| 14 | OK524222 | Lariophagus texanus voucher CNIN3707ROO cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 577 | 85.7% | 652.657 | 0.00e+00 | 89.3% |
| 15 | GU675361 | Pteromalidae sp. BOLD:AAG1902 voucher MTCHA-0014 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 708.16 | 0.00e+00 | 88.7% |
| 16 | GU675362 | Pteromalidae sp. BOLD:AAG1902 voucher MTCHA-0019 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 704.195 | 0.00e+00 | 88.7% |
| 17 | OP498202 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_micro_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 720.054 | 0.00e+00 | 88.6% |
| 18 | OP498214 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_relig_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 712.124 | 0.00e+00 | 88.5% |
| 19 | KR803055 | Achrysocharoides cilla voucher BIOUG01285-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 89.5% | 638.781 | 2.81e-178 | 88.4% |
| 20 | OP498215 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_relig_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 704.195 | 0.00e+00 | 88.3% |
| 21 | OP498216 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_relig_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 704.195 | 0.00e+00 | 88.3% |
| 22 | KY836675 | Pteromalidae sp. BIOUG04746-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 93.0% | 662.568 | 0.00e+00 | 88.3% |
| 23 | MG783996 | Pteromalus aff. altus A_HB voucher BC-ZSM-HYM-01772-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.0% | 609.047 | 2.51e-169 | 88.3% |
| 24 | KR924884 | Cecidostiba sp. BOLD-2016 voucher BIOUG19094-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 76.5% | 529.756 | 1.86e-145 | 88.0% |
| 25 | KR929645 | Cecidostiba sp. BOLD-2016 voucher BIOUG19364-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 76.5% | 529.756 | 1.86e-145 | 88.0% |
| 26 | MG498332 | Cecidostiba sp. BIOUG20774-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 76.5% | 529.756 | 1.86e-145 | 88.0% |
| 27 | KJ166673 | Pteromalidae sp. BOLD:ACC7754 voucher BIOUG03445-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 666.532 | 0.00e+00 | 87.9% |
| 28 | MG375766 | Pteromalidae sp. BIOUG25540-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 646.71 | 1.15e-180 | 87.9% |
| 29 | MG377470 | Pteromalidae sp. BIOUG25467-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 644.728 | 4.56e-180 | 87.9% |
| 30 | OQ134223 | Pteromalidae sp. voucher F38 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 563 | 83.7% | 577.331 | 8.87e-160 | 87.9% |
| 31 | MG380735 | Cecidostiba sp. BIOUG27401-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 561.473 | 5.27e-155 | 87.9% |
| 32 | KR933954 | Cecidostiba sp. BOLD-2016 voucher BIOUG19061-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 557.508 | 8.22e-154 | 87.9% |
| 33 | KR925054 | Cecidostiba sp. BOLD-2016 voucher BIOUG19565-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 557.508 | 8.22e-154 | 87.9% |
| 34 | KR928333 | Cecidostiba sp. BOLD-2016 voucher BIOUG19996-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 557.508 | 8.22e-154 | 87.9% |
| 35 | KR928891 | Cecidostiba sp. BOLD-2016 voucher BIOUG19996-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 557.508 | 8.22e-154 | 87.9% |
| 36 | KR927739 | Cecidostiba sp. BOLD-2016 voucher BIOUG19364-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 557.508 | 8.22e-154 | 87.9% |
| 37 | KM556563 | Pteromalidae sp. BOLD:ACC6420 voucher BIOUG03235-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 658.603 | 0.00e+00 | 87.8% |
| 38 | KR933094 | Cecidostiba sp. BOLD-2016 voucher BIOUG19565-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 82.9% | 567.419 | 8.54e-157 | 87.8% |
| 39 | KR931220 | Cecidostiba sp. BOLD-2016 voucher BIOUG19455-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 542 | 80.5% | 551.561 | 5.07e-152 | 87.8% |
| 40 | MG499978 | Cecidostiba sp. BIOUG20779-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 540 | 80.2% | 547.597 | 7.92e-151 | 87.8% |
| 41 | KR933465 | Cecidostiba sp. BOLD-2016 voucher BIOUG19365-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 534 | 79.3% | 543.632 | 1.24e-149 | 87.8% |
| 42 | KR929044 | Cecidostiba sp. BOLD-2016 voucher BIOUG19456-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 534 | 79.3% | 543.632 | 1.24e-149 | 87.8% |
| 43 | KR931083 | Cecidostiba sp. BOLD-2016 voucher BIOUG19995-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 534 | 79.3% | 543.632 | 1.24e-149 | 87.8% |
| 44 | MG497153 | Cecidostiba sp. BIOUG20779-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 76.5% | 525.792 | 2.90e-144 | 87.8% |
| 45 | MG505136 | Cecidostiba sp. BIOUG19840-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 76.5% | 523.81 | 1.15e-143 | 87.8% |
| 46 | MG504374 | Cecidostiba sp. BIOUG20775-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 76.5% | 521.827 | 4.53e-143 | 87.8% |
| 47 | OP498184 | Sycoscapter sp. voucher Sy_glabe_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 672.479 | 0.00e+00 | 87.7% |
| 48 | KR891350 | Pteromalidae sp. BOLD-2016 voucher BIOUG00786-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 658.603 | 0.00e+00 | 87.7% |
| 49 | KR784657 | Achrysocharoides cilla voucher BIOUG01284-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 654.639 | 0.00e+00 | 87.7% |
| 50 | OQ134225 | Pteromalidae sp. voucher F47 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 563 | 83.7% | 569.402 | 2.16e-157 | 87.7% |
| 51 | MG504746 | Pteromalidae sp. BIOUG21578-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 566 | 84.1% | 567.419 | 8.54e-157 | 87.7% |
| 52 | KR934248 | Cecidostiba sp. BOLD-2016 voucher BIOUG20144-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 551.561 | 5.07e-152 | 87.7% |
| 53 | KR926367 | Cecidostiba sp. BOLD-2016 voucher BIOUG19631-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 549.579 | 2.00e-151 | 87.7% |
| 54 | KR925884 | Cecidostiba sp. BOLD-2016 voucher BIOUG19565-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 549.579 | 2.00e-151 | 87.7% |
| 55 | KR923550 | Cecidostiba sp. BOLD-2016 voucher BIOUG19456-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 549.579 | 2.00e-151 | 87.7% |
| 56 | OL538102 | Atrichomalus trianellatus voucher SMNS_38112 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 648.692 | 0.00e+00 | 87.6% |
| 57 | MF956204 | Pseudotorymus napi voucher GDEL3028 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 648.692 | 0.00e+00 | 87.6% |
| 58 | KR798905 | Pteromalidae sp. BOLD-2016 voucher BIOUG02507-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 91.4% | 616.976 | 1.03e-171 | 87.6% |
| 59 | KM562350 | Pteromalidae sp. BOLD:AAG7948 voucher BIOUG04285-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 603.1 | 1.55e-167 | 87.6% |
| 60 | MG498515 | Cecidostiba sp. BIOUG20774-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 89.6% | 601.118 | 6.13e-167 | 87.6% |
| 61 | KR874803 | Pteromalus sp. BOLD-2016 voucher BIOUG10741-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 88.6% | 595.171 | 3.78e-165 | 87.6% |
| 62 | JN300347 | Hymenoptera sp. BOLD:AAU9873 voucher BIOUG| 589 |
87.5% |
589.224 |
2.33e-163 |
87.6% |
|
| 63 | KR924299 | Cecidostiba sp. BOLD-2016 voucher BIOUG19456-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 82.9% | 559.49 | 2.08e-154 | 87.6% |
| 64 | KR924228 | Cecidostiba sp. BOLD-2016 voucher BIOUG19062-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 81.4% | 547.597 | 7.92e-151 | 87.6% |
| 65 | KR929098 | Cecidostiba sp. BOLD-2016 voucher BIOUG19996-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 525 | 78.0% | 525.792 | 2.90e-144 | 87.6% |
| 66 | KR801934 | Pteromalidae sp. BOLD-2016 voucher BIOUG02507-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 93.0% | 622.923 | 1.67e-173 | 87.5% |
| 67 | JX831460 | Hymenoptera sp. BOLD:AAU4878 voucher TWPARA-1058 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.1% | 605.082 | 3.92e-168 | 87.5% |
| 68 | MG379686 | Pachyneuron groenlandicum voucher 08WOLVES-00836 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 603.1 | 1.55e-167 | 87.5% |
| 69 | KR924744 | Cecidostiba sp. BOLD-2016 voucher BIOUG19456-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 89.5% | 599.136 | 2.42e-166 | 87.5% |
| 70 | KR931511 | Cecidostiba sp. BOLD-2016 voucher BIOUG19364-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 578 | 85.9% | 575.348 | 3.50e-159 | 87.5% |
| 71 | KR933861 | Cecidostiba sp. BOLD-2016 voucher BIOUG19364-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 578 | 85.9% | 575.348 | 3.50e-159 | 87.5% |
| 72 | MG497227 | Pteromalidae sp. BIOUG21601-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 566 | 84.1% | 559.49 | 2.08e-154 | 87.5% |
| 73 | MG499055 | Cecidostiba sp. BIOUG19840-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 543.632 | 1.24e-149 | 87.5% |
| 74 | KY832731 | Eulophidae sp. BIOUG04751-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 545 | 81.0% | 541.65 | 4.88e-149 | 87.5% |
| 75 | KT623736 | Eurytomidae sp. BOLD:ACV3443 voucher BIOUG22578-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 537 | 79.8% | 533.721 | 1.19e-146 | 87.5% |
| 76 | JN292242 | Pteromalidae sp. BBHYI107-10 voucher BIOUG| 651 |
96.7% |
640.763 |
7.12e-179 |
87.4% |
|
| 77 | KM556849 | Pteromalidae sp. BOLD:AAM7430 voucher BIOUG06357-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 93.2% | 618.958 | 2.61e-172 | 87.4% |
| 78 | KM501054 | Trichogramma achaeae isolate Ta9 cytochrome oxidase subunit I (CO1) gene, partial cds; mitochondrial | 626 | 93.0% | 614.994 | 4.07e-171 | 87.4% |
| 79 | KR782528 | Achrysocharoides cilla voucher BIOUG01115-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 610 | 90.6% | 599.136 | 2.42e-166 | 87.4% |
| 80 | KR932183 | Cecidostiba sp. BOLD-2016 voucher BIOUG19090-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 605 | 89.9% | 599.136 | 2.42e-166 | 87.4% |
| 81 | FM210164 | Metaphycus flavus mitochondrial partial coi gene for cytochrome oxidase sub-unit 1, exon 1, allele H1 | 608 | 90.3% | 595.171 | 3.78e-165 | 87.4% |
| 82 | MG506492 | Cecidostiba sp. BIOUG20774-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 88.1% | 585.26 | 3.64e-162 | 87.4% |
| 83 | KR925461 | Cecidostiba sp. BOLD-2016 voucher BIOUG19566-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 585 | 86.9% | 573.366 | 1.38e-158 | 87.4% |
| 84 | KR933274 | Cecidostiba sp. BOLD-2016 voucher BIOUG19566-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.0% | 563.455 | 1.33e-155 | 87.4% |
| 85 | KR929182 | Cecidostiba sp. BOLD-2016 voucher BIOUG19363-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.0% | 563.455 | 1.33e-155 | 87.4% |
| 86 | MG383044 | Pteromalidae sp. BIOUG23541-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 84.7% | 559.49 | 2.08e-154 | 87.4% |
| 87 | MG500415 | Pteromalidae sp. BIOUG21476-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 557.508 | 8.22e-154 | 87.4% |
| 88 | JX833330 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG00732-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 557.508 | 8.22e-154 | 87.4% |
| 89 | OP292605 | Achrysocharoides cilla voucher NK877 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 557.508 | 8.22e-154 | 87.4% |
| 90 | OP292573 | Achrysocharoides cilla voucher NK897 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 557.508 | 8.22e-154 | 87.4% |
| 91 | MG376631 | Cecidostiba sp. BIOUG23771-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 549 | 81.6% | 541.65 | 4.88e-149 | 87.4% |
| 92 | MG946790 | Metaphycus flavus isolate 03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 670 | 99.6% | 654.639 | 0.00e+00 | 87.3% |
| 93 | MG946791 | Metaphycus flavus isolate 06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 670 | 99.6% | 654.639 | 0.00e+00 | 87.3% |
| 94 | MG376826 | Pteromalidae sp. BIOUG24652-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 634.816 | 4.39e-177 | 87.3% |
| 95 | OP443516 | Trichogramma sp. voucher YT-198 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 632.834 | 1.74e-176 | 87.3% |
| 96 | KR898157 | Pteromalus sp. BOLD-2016 voucher BIOUG07356-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 632.834 | 1.74e-176 | 87.3% |
| 97 | MF905142 | Eurytomidae sp. BIOUG14374-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 613.011 | 1.61e-170 | 87.3% |
| 98 | MG335579 | Eulophidae sp. BIOUG12461-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 92.6% | 609.047 | 2.51e-169 | 87.3% |
| 99 | JX828496 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG00761-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.1% | 597.153 | 9.56e-166 | 87.3% |
| 100 | JX828924 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG00782-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.1% | 597.153 | 9.56e-166 | 87.3% |
| 101 | JX829746 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG00766-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.1% | 597.153 | 9.56e-166 | 87.3% |
| 102 | KM555823 | Pteromalidae sp. BOLD:ACD3603 voucher BIOUG04667-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 597.153 | 9.56e-166 | 87.3% |
| 103 | JX833262 | Hymenoptera sp. BOLD:AAU4878 voucher TWPARA-1059 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 595.171 | 3.78e-165 | 87.3% |
| 104 | JX830910 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG00766-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 593.189 | 1.49e-164 | 87.3% |
| 105 | MG506643 | Cecidostiba sp. BIOUG20776-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.2% | 589.224 | 2.33e-163 | 87.3% |
| 106 | MG500055 | Pteromalidae sp. BIOUG21597-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 581 | 86.3% | 565.437 | 3.37e-156 | 87.3% |
| 107 | KR931079 | Cecidostiba sp. BOLD-2016 voucher BIOUG19995-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 557.508 | 8.22e-154 | 87.3% |
| 108 | KR934731 | Cecidostiba sp. BOLD-2016 voucher BIOUG19455-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 557.508 | 8.22e-154 | 87.3% |
| 109 | MG498451 | Pteromalidae sp. BIOUG21833-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.0% | 555.526 | 3.25e-153 | 87.3% |
| 110 | MG501478 | Pteromalidae sp. BIOUG21675-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 557 | 82.8% | 541.65 | 4.88e-149 | 87.3% |
| 111 | MG504761 | Pteromalidae sp. BIOUG21596-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 82.3% | 535.703 | 3.01e-147 | 87.3% |
| 112 | MG501826 | Cecidostiba sp. BIOUG20775-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 542 | 80.5% | 529.756 | 1.86e-145 | 87.3% |
| 113 | MN667490 | Pachyneuron groenlandicum voucher CHARS00157-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 626.887 | 1.07e-174 | 87.2% |
| 114 | MH456778 | Metaphycus flavus voucher 25015 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 626.887 | 1.07e-174 | 87.2% |
| 115 | MH456780 | Metaphycus flavus voucher 25033 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 626.887 | 1.07e-174 | 87.2% |
| 116 | KR788665 | Pteromalidae sp. BOLD-2016 voucher BIOUG01018-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 624.905 | 4.23e-174 | 87.2% |
| 117 | MN677161 | Pteromalidae sp. BOLD:ADU0204 voucher CHARS00256-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 624.905 | 4.23e-174 | 87.2% |
| 118 | OP443543 | Trichogramma sp. voucher YT-226 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 624.905 | 4.23e-174 | 87.2% |
| 119 | KR876758 | Eulophidae sp. BOLD-2016 voucher BIOUG07816-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 618 | 91.8% | 599.136 | 2.42e-166 | 87.2% |
| 120 | JX831861 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG00761-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 609 | 90.5% | 589.224 | 2.33e-163 | 87.2% |
| 121 | OK085480 | Anagyrus lopezi isolate AL-BENIN cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 606 | 90.0% | 583.277 | 1.44e-161 | 87.2% |
| 122 | OL538105 | Trigonoderus nobilitatus voucher SMNS_39901 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 595 | 88.4% | 577.331 | 8.87e-160 | 87.2% |
| 123 | MG932214 | Trichogramma achaeae voucher 25417 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 88.1% | 573.366 | 1.38e-158 | 87.2% |
| 124 | JX829945 | Hymenoptera sp. BOLD:AAU4878 voucher TWPARA-1057 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 84.7% | 553.543 | 1.28e-152 | 87.2% |
| 125 | KM563051 | Pteromalidae sp. BOLD:AAU9134 voucher BIOUG03166-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 84.7% | 551.561 | 5.07e-152 | 87.2% |
| 126 | OQ134199 | Pteromalidae sp. voucher F18 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 563 | 83.7% | 549.579 | 2.00e-151 | 87.2% |
| 127 | JX833525 | Hymenoptera sp. BOLD:AAU4878 voucher TWPARA-1056 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 83.7% | 545.614 | 3.13e-150 | 87.2% |
| 128 | KR374261 | Pteromalidae sp. BOLD:AAU9873 voucher BIOUG11049-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 556 | 82.6% | 541.65 | 4.88e-149 | 87.2% |
| 129 | HQ929634 | Pteromalidae sp. BOLD:AAN7689 voucher BIOUG| 651 |
96.7% |
624.905 |
4.23e-174 |
87.1% |
|
| 130 | HQ929599 | Pteromalidae sp. BOLD:AAN7689 voucher BIOUG| 651 |
96.7% |
624.905 |
4.23e-174 |
87.1% |
|
| 131 | MH456723 | Metaphycus flavus voucher 23795 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 618.958 | 2.61e-172 | 87.1% |
| 132 | MK530766 | Walkerella nigrabdomina voucher Wa_pisoc_4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 637 | 94.7% | 605.082 | 3.92e-168 | 87.1% |
| 133 | KR802079 | Tetrastichinae sp. BOLD-2016 voucher BIOUG07644-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 595.171 | 3.78e-165 | 87.1% |
| 134 | KR795680 | Achrysocharoides sp. BOLD-2016 voucher BIOUG08422-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 610 | 90.6% | 583.277 | 1.44e-161 | 87.1% |
| 135 | JX828719 | Hymenoptera sp. BOLD:AAU4878 voucher 10PROBE-28598 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 598 | 88.9% | 575.348 | 3.50e-159 | 87.1% |
| 136 | MG504119 | Pteromalidae sp. BIOUG21831-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 86.5% | 559.49 | 2.08e-154 | 87.1% |
| 137 | MG498182 | Pteromalidae sp. BIOUG21597-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.0% | 549.579 | 2.00e-151 | 87.1% |
| 138 | MG503412 | Pteromalidae sp. BIOUG21598-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.0% | 547.597 | 7.92e-151 | 87.1% |
| 139 | MG503996 | Pteromalidae sp. BIOUG20477-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.0% | 547.597 | 7.92e-151 | 87.1% |
| 140 | KM558981 | Pteromalidae sp. BOLD:AAU9134 voucher BIOUG03166-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 84.7% | 543.632 | 1.24e-149 | 87.1% |
| 141 | MG504863 | Pteromalidae sp. BIOUG21833-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 543.632 | 1.24e-149 | 87.1% |
| 142 | MG505225 | Pteromalidae sp. BIOUG21833-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 84.5% | 541.65 | 4.88e-149 | 87.1% |
| 143 | MZ630773 | Achrysocharoides cilla voucher ZMUO.027064 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 565 | 84.0% | 541.65 | 4.88e-149 | 87.1% |
| 144 | MG503961 | Cecidostiba sp. BIOUG20776-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 82.9% | 537.685 | 7.62e-148 | 87.1% |
| 145 | KR928210 | Cecidostiba sp. BOLD-2016 voucher BIOUG19995-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 82.9% | 535.703 | 3.01e-147 | 87.1% |
| 146 | MG497531 | Pteromalidae sp. BIOUG21680-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 557 | 82.8% | 533.721 | 1.19e-146 | 87.1% |
| 147 | MG500357 | Pteromalidae sp. BIOUG21833-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 554 | 82.3% | 529.756 | 1.86e-145 | 87.1% |
| 148 | KR935127 | Cecidostiba sp. BOLD-2016 voucher BIOUG19455-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 542 | 80.5% | 523.81 | 1.15e-143 | 87.1% |
| 149 | OP498182 | Sycoscapter sp. voucher Sy_glabe_1_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 632.834 | 1.74e-176 | 87.0% |
| 150 | MN667214 | Pachyneuron groenlandicum voucher CHARS00120-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 618.958 | 2.61e-172 | 87.0% |
| 151 | JN300905 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG| 652 |
96.9% |
618.958 |
2.61e-172 |
87.0% |
|
| 152 | MG343509 | Tetrastichinae sp. BIOUG24493-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 618.958 | 2.61e-172 | 87.0% |
| 153 | KP994548 | Trichogramma achaeae voucher CUTA 03-A1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 616.976 | 1.03e-171 | 87.0% |
| 154 | OP443478 | Trichogramma sp. voucher YT-086 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 616.976 | 1.03e-171 | 87.0% |
| 155 | OP443517 | Trichogramma sp. voucher YT-199 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 616.976 | 1.03e-171 | 87.0% |
| 156 | MN675192 | Pachyneuron groenlandicum voucher CHARS00261-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 616.976 | 1.03e-171 | 87.0% |
| 157 | OP443530 | Trichogramma sp. voucher YT-014 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 616.976 | 1.03e-171 | 87.0% |
| 158 | OQ272751 | Pteromalidae sp. voucher 07000MS082021 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 616.976 | 1.03e-171 | 87.0% |
| 159 | KF444823 | Pteromalus sp. AAF-2013 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 616.976 | 1.03e-171 | 87.0% |
| 160 | KR786723 | Pteromalidae sp. BOLD-2016 voucher BIOUG01601-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 611.029 | 6.36e-170 | 87.0% |
| 161 | MG340083 | Aprostocetus sp. BIOUG25571-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 599.136 | 2.42e-166 | 87.0% |
| 162 | KR807343 | Pteromalidae sp. BOLD-2016 voucher BIOUG01284-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 92.7% | 595.171 | 3.78e-165 | 87.0% |
| 163 | KR784729 | Pteromalidae sp. BOLD-2016 voucher BIOUG01327-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 92.6% | 593.189 | 1.49e-164 | 87.0% |
| 164 | KR808637 | Pteromalidae sp. BOLD-2016 voucher BIOUG17722-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 585.26 | 3.64e-162 | 87.0% |
| 165 | JX828848 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG00770-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 609 | 90.5% | 581.295 | 5.68e-161 | 87.0% |
| 166 | KR894200 | Eulophidae sp. BOLD-2016 voucher BIOUG00862-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 579.313 | 2.24e-160 | 87.0% |
| 167 | HQ928898 | Eulophidae sp. BBHEC797-10 voucher BIOUG| 608 |
90.3% |
579.313 |
2.24e-160 |
87.0% |
|
| 168 | KR874196 | Pteromalus sp. BOLD-2016 voucher BIOUG11321-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 88.0% | 563.455 | 1.33e-155 | 87.0% |
| 169 | KR886401 | Pteromalidae sp. BOLD-2016 voucher BIOUG07255-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 84.7% | 543.632 | 1.24e-149 | 87.0% |
| 170 | MG504872 | Pteromalidae sp. BIOUG21600-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 558 | 82.9% | 527.774 | 7.34e-145 | 87.0% |
| 171 | KR788464 | Aphelinidae sp. BOLD-2016 voucher BIOUG03599-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 547 | 81.3% | 521.827 | 4.53e-143 | 87.0% |
| 172 | PP111119 | Sycoscapter sp. voucher NBAIR-280423 A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 670 | 99.6% | 642.745 | 1.80e-179 | 86.9% |
| 173 | MN682850 | Pachyneuron groenlandicum voucher CHARS00261-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 611.029 | 6.36e-170 | 86.9% |
| 174 | MN673697 | Pachyneuron groenlandicum voucher CHARS00170-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 611.029 | 6.36e-170 | 86.9% |
| 175 | OK205262 | Trichogramma australicum voucher HB_NUU_16_1_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 611.029 | 6.36e-170 | 86.9% |
| 176 | MN679507 | Pachyneuron groenlandicum voucher CHARS00193-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 611.029 | 6.36e-170 | 86.9% |
| 177 | MN681150 | Pachyneuron groenlandicum voucher CHARS00206-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 609.047 | 2.51e-169 | 86.9% |
| 178 | OP443476 | Trichogramma sp. voucher YT-089 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 609.047 | 2.51e-169 | 86.9% |
| 179 | MN670668 | Pachyneuron groenlandicum voucher CHARS00141-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 609.047 | 2.51e-169 | 86.9% |
| 180 | OP443532 | Trichogramma sp. voucher YT-012 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 609.047 | 2.51e-169 | 86.9% |
| 181 | MK530763 | Walkerella sp. 2 AYW-2019 voucher Wa_glabe_3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 637 | 94.7% | 597.153 | 9.56e-166 | 86.9% |
| 182 | KM559986 | Pteromalus sp. BOLD:AAU9358 voucher BIOUG07384-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 591.206 | 5.90e-164 | 86.9% |
| 183 | MG513392 | Pteromalidae sp. BIOUG10170-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 591.206 | 5.90e-164 | 86.9% |
| 184 | KU496780 | Mesopolobus verditer cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 579.313 | 2.24e-160 | 86.9% |
| 185 | KM559405 | Pteromalidae sp. BOLD:AAU9134 voucher BIOUG03112-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 577.331 | 8.87e-160 | 86.9% |
| 186 | KJ166182 | Pteromalidae sp. BOLD:AAG8352 voucher BIOUG03688-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 610 | 90.6% | 575.348 | 3.50e-159 | 86.9% |
| 187 | KC685223 | Eurytoma aff. spongiosa 1 YMZ-2013 voucher MZEUR-0106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 571.384 | 5.47e-158 | 86.9% |
| 188 | MF905502 | Eulophidae sp. BIOUG20901-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.2% | 547.597 | 7.92e-151 | 86.9% |
| 189 | KY839604 | Aphelinidae sp. BIOUG02447-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 571 | 84.8% | 537.685 | 7.62e-148 | 86.9% |
| 190 | MG497834 | Pteromalidae sp. BIOUG21834-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 564 | 83.8% | 533.721 | 1.19e-146 | 86.9% |
| 191 | OQ134244 | Pteromalidae sp. voucher F26 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 563 | 83.7% | 529.756 | 1.86e-145 | 86.9% |
| 192 | KR893494 | Pteromalidae sp. BOLD-2016 voucher BIOUG07360-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 83.7% | 529.756 | 1.86e-145 | 86.9% |
| 193 | KR893098 | Pteromalidae sp. BOLD-2016 voucher BIOUG07390-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 83.7% | 529.756 | 1.86e-145 | 86.9% |
| 194 | OP498183 | Sycoscapter sp. voucher Sy_glabe_1_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 624.905 | 4.23e-174 | 86.8% |
| 195 | KR797526 | Aphelinus sp. BOLD-2016 voucher BIOUG06823-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 609.047 | 2.51e-169 | 86.8% |
| 196 | MG505937 | Pteromalidae sp. BIOUG26717-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 609.047 | 2.51e-169 | 86.8% |
| 197 | LC201495 | Hymenoptera sp. P2 mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 650 | 96.6% | 607.065 | 9.93e-169 | 86.8% |
| 198 | MN682251 | Pachyneuron groenlandicum voucher CHARS00274-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 605.082 | 3.92e-168 | 86.8% |
| 199 | MN680972 | Pachyneuron groenlandicum voucher CHARS00281-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 644 | 95.7% | 603.1 | 1.55e-167 | 86.8% |
| 200 | KR370268 | Chlorocytus sp. BOLD:AAM7430 voucher BIOUG11021-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 92.6% | 589.224 | 2.33e-163 | 86.8% |
| 201 | HQ106708 | Baryscapus coerulescens voucher EE-46-89 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 620 | 92.1% | 577.331 | 8.87e-160 | 86.8% |
| 202 | KR368323 | Pteromalidae sp. BOLD:ABW3164 voucher BIOUG10057-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 575.348 | 3.50e-159 | 86.8% |
| 203 | KM562391 | Pteromalidae sp. BOLD:ABW3164 voucher BIOUG03621-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 573.366 | 1.38e-158 | 86.8% |
| 204 | KR901044 | Eulophidae sp. BOLD-2016 voucher BIOUG12264-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 86.5% | 545.614 | 3.13e-150 | 86.8% |
| 205 | KR932701 | Pteromalidae sp. BOLD-2016 voucher BIOUG19316-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 86.5% | 543.632 | 1.24e-149 | 86.8% |
| 206 | KM564533 | Pteromalidae sp. BOLD:AAM7430 voucher 09BBEHY-1438 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 577 | 85.7% | 541.65 | 4.88e-149 | 86.8% |
| 207 | KR894552 | Pteromalidae sp. BOLD-2016 voucher BIOUG07360-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 575 | 85.4% | 537.685 | 7.62e-148 | 86.8% |
| 208 | MZ630812 | Pachyneuron sp. ZMUO 026892 voucher ZMUO.026892 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 568 | 84.4% | 531.739 | 4.70e-146 | 86.8% |
| 209 | KR926065 | Pteromalidae sp. BOLD-2016 voucher BIOUG20123-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 561 | 83.4% | 525.792 | 2.90e-144 | 86.8% |
| 210 | KR898195 | Pteromalidae sp. BOLD-2016 voucher BIOUG08062-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 561 | 83.4% | 525.792 | 2.90e-144 | 86.8% |
| 211 | KR887110 | Torymidae sp. BOLD-2016 voucher BIOUG08658-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 605.082 | 3.92e-168 | 86.7% |
| 212 | MG343086 | Tetrastichinae sp. BIOUG24652-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 605.082 | 3.92e-168 | 86.7% |
| 213 | MZ632618 | Achrysocharoides sp. ZMUO 026955 voucher ZMUO.026955 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 601.118 | 6.13e-167 | 86.7% |
| 214 | MF929198 | Aphelinidae sp. BIOUG27501-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 601.118 | 6.13e-167 | 86.7% |
| 215 | KM562531 | Hymenoptera sp. BOLD:ACD0943 voucher BIOUG04164-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 601.118 | 6.13e-167 | 86.7% |
| 216 | KR787348 | Eulophidae sp. BOLD-2016 voucher BIOUG01029-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 601.118 | 6.13e-167 | 86.7% |
| 217 | MF956358 | Pseudotorymus sp. PJAN1154 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 601.118 | 6.13e-167 | 86.7% |
| 218 | MN670539 | Pachyneuron groenlandicum voucher CHARS00170-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 95.1% | 595.171 | 3.78e-165 | 86.7% |
| 219 | MK530764 | Walkerella nigrabdomina voucher Wa_pisoc_2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 637 | 94.7% | 589.224 | 2.33e-163 | 86.7% |
| 220 | KR374131 | Chlorocytus sp. BOLD:AAM7430 voucher BIOUG11066-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 93.0% | 585.26 | 3.64e-162 | 86.7% |
| 221 | KM558412 | Pachyneuron groenlandicum voucher BIOUG03121-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 575.348 | 3.50e-159 | 86.7% |
| 222 | MG343474 | Eulophidae sp. BIOUG08742-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 573.366 | 1.38e-158 | 86.7% |
| 223 | HQ106730 | Baryscapus coerulescens voucher EE-535-91 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 617 | 91.7% | 571.384 | 5.47e-158 | 86.7% |
| 224 | KR892042 | Eulophidae sp. BOLD-2016 voucher BIOUG10381-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 567.419 | 8.54e-157 | 86.7% |
| 225 | KR370664 | Mesopolobus verditer voucher BIOUG10687-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 565.437 | 3.37e-156 | 86.7% |
| 226 | KR367718 | Pachyneuron sp. BOLD:ACM3913 voucher BIOUG11514-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 565.437 | 3.37e-156 | 86.7% |
| 227 | KR367820 | Chlorocytus sp. BOLD:AAM7430 voucher BIOUG11020-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 563.455 | 1.33e-155 | 86.7% |
| 228 | KR409028 | Aphelinus sp. BOLD:ACP2973 voucher BIOUG11246-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 606 | 90.0% | 559.49 | 2.08e-154 | 86.7% |
| 229 | MG784023 | Pteromalus intermedius voucher BC-ZSM-HYM-01772-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.2% | 555.526 | 3.25e-153 | 86.7% |
| 230 | KR806058 | Eulophidae sp. BOLD-2016 voucher BIOUG01606-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 584 | 86.8% | 539.668 | 1.93e-148 | 86.7% |
| 231 | MF900117 | Pnigalio maculipes voucher BIOUG21502-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 578 | 85.9% | 535.703 | 3.01e-147 | 86.7% |
| 232 | KM567938 | Pteromalus sp. BOLD:AAU9358 voucher 10BBCHY-1142 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 577 | 85.7% | 533.721 | 1.19e-146 | 86.7% |
| 233 | OQ134198 | Pteromalidae sp. voucher E22 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 566 | 84.1% | 527.774 | 7.34e-145 | 86.7% |
| 234 | OQ134256 | Pteromalidae sp. voucher F91 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 566 | 84.1% | 527.774 | 7.34e-145 | 86.7% |
| 235 | MG504667 | Pteromalidae sp. BIOUG21476-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 563 | 83.7% | 523.81 | 1.15e-143 | 86.7% |
| 236 | OP292575 | Achrysocharoides cilla voucher NK881 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 599.136 | 2.42e-166 | 86.6% |
| 237 | OP292631 | Achrysocharoides cilla voucher NK884 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 599.136 | 2.42e-166 | 86.6% |
| 238 | HQ106776 | Baryscapus sp. MAS-2010 voucher EE-12813ii-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 599.136 | 2.42e-166 | 86.6% |
| 239 | OP292585 | Achrysocharoides cilla voucher NK894 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 599.136 | 2.42e-166 | 86.6% |
| 240 | KR900641 | Eulophidae sp. BOLD-2016 voucher BIOUG01309-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 589.224 | 2.33e-163 | 86.6% |
| 241 | HQ106775 | Baryscapus sp. MAS-2010 voucher EE-12815ii-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 629 | 93.5% | 579.313 | 2.24e-160 | 86.6% |
| 242 | KM565014 | Mesopolobus sp. BOLD:AAU9280 voucher 10BBCHY-1668 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 93.2% | 577.331 | 8.87e-160 | 86.6% |
| 243 | KR792384 | Pteromalus sp. BOLD-2016 voucher BIOUG12627-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 575.348 | 3.50e-159 | 86.6% |
| 244 | KR365324 | Chlorocytus sp. BOLD:AAM7430 voucher BIOUG10873-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 575.348 | 3.50e-159 | 86.6% |
| 245 | KJ637614 | Aphelinidae sp. BOLD:ACE0410 voucher BIOUG03764-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 92.3% | 573.366 | 1.38e-158 | 86.6% |
| 246 | HQ106749 | Baryscapus coerulescens voucher EE-12-89 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 620 | 92.1% | 569.402 | 2.16e-157 | 86.6% |
| 247 | KT707676 | Eulophidae sp. BOLD:AAG8352 voucher BIOUG24008-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 561.473 | 5.27e-155 | 86.6% |
| 248 | OP292602 | Achrysocharoides cilla voucher NK876 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 561.473 | 5.27e-155 | 86.6% |
| 249 | KC685217 | Eurytoma aff. spongiosa 1 YMZ-2013 voucher MZEUR-0099 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 555.526 | 3.25e-153 | 86.6% |
| 250 | MG932197 | Trichogramma dendrolimi voucher 179 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 88.1% | 541.65 | 4.88e-149 | 86.6% |
| 251 | KR892898 | Cecidostiba sp. BOLD-2016 voucher BIOUG11673-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 86.5% | 535.703 | 3.01e-147 | 86.6% |
| 252 | OQ134222 | Pteromalidae sp. voucher E12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 566 | 84.1% | 523.81 | 1.15e-143 | 86.6% |
| 253 | HQ106727 | Baryscapus coerulescens voucher EE-174-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 595.171 | 3.78e-165 | 86.5% |
| 254 | KM556852 | Pteromalidae sp. BOLD:ACD0516 voucher BIOUG04047-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 255 | HQ106738 | Baryscapus coerulescens voucher EE-1314-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 256 | MZ630489 | Hymenoptera sp. ZMUO 026957 voucher ZMUO.026957 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 257 | HQ106744 | Baryscapus coerulescens voucher EE-67-93 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 258 | KR877210 | Eulophidae sp. BOLD-2016 voucher BIOUG01309-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 259 | KR805525 | Eulophidae sp. BOLD-2016 voucher BIOUG01284-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 260 | KJ167893 | Aphelinidae sp. BOLD:ACE0410 voucher BIOUG03688-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 261 | HQ106755 | Baryscapus coerulescens voucher EE-193-88 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 262 | HQ106686 | Baryscapus coerulescens voucher EE-7057-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 593.189 | 1.49e-164 | 86.5% |
| 263 | HQ106770 | Baryscapus sp. MAS-2010 voucher EE-13308i-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 591.206 | 5.90e-164 | 86.5% |
| 264 | KR893276 | Cecidostiba sp. BOLD-2016 voucher BIOUG07360-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 591.206 | 5.90e-164 | 86.5% |
| 265 | HQ106685 | Baryscapus coerulescens voucher EE-7035-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 591.206 | 5.90e-164 | 86.5% |
| 266 | HQ106698 | Baryscapus coerulescens voucher EE-213-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 591.206 | 5.90e-164 | 86.5% |
| 267 | KR368683 | Chlorocytus sp. BOLD:AAM7430 voucher BIOUG10873-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 92.7% | 577.331 | 8.87e-160 | 86.5% |
| 268 | MF929666 | Aphelinidae sp. BIOUG26785-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 92.6% | 569.402 | 2.16e-157 | 86.5% |
| 269 | OP292608 | Achrysocharoides cilla voucher NK893 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 622 | 92.4% | 567.419 | 8.54e-157 | 86.5% |
| 270 | OP292618 | Achrysocharoides cilla voucher NK878 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 92.3% | 565.437 | 3.37e-156 | 86.5% |
| 271 | KF444822 | Halticopteroides exemae isolate OTU005A-Hexemae-Ribes-F-2005-B cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 563.455 | 1.33e-155 | 86.5% |
| 272 | HQ106677 | Baryscapus coerulescens voucher EE-202-85 P1 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 617 | 91.7% | 563.455 | 1.33e-155 | 86.5% |
| 273 | HQ106745 | Baryscapus coerulescens voucher EE-65-93 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 617 | 91.7% | 563.455 | 1.33e-155 | 86.5% |
| 274 | HQ106692 | Baryscapus coerulescens voucher EE-7088iv-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 617 | 91.7% | 563.455 | 1.33e-155 | 86.5% |
| 275 | HQ106772 | Baryscapus sp. MAS-2010 voucher EE-13312-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 617 | 91.7% | 563.455 | 1.33e-155 | 86.5% |
| 276 | MF931414 | Aphelinidae sp. BIOUG27598-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 563.455 | 1.33e-155 | 86.5% |
| 277 | JN293274 | Pteromalidae sp. BBHYK397-10 voucher BIOUG| 613 |
91.1% |
557.508 |
8.22e-154 |
86.5% |
|
| 278 | MZ632299 | Hymenoptera sp. ZMUO 026954 voucher ZMUO.026954 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 555.526 | 3.25e-153 | 86.5% |
| 279 | JN289103 | Hymenoptera sp. BOLD:AAU8693 voucher BIOUG| 605 |
89.9% |
549.579 |
2.00e-151 |
86.5% |
|
| 280 | MG784018 | Pteromalus intermedius voucher BC-ZSM-HYM-01772-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 87.7% | 535.703 | 3.01e-147 | 86.5% |
| 281 | MG784003 | Pteromalus intermedius voucher BC-ZSM-HYM-01772-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 87.7% | 535.703 | 3.01e-147 | 86.5% |
| 282 | MG784041 | Pteromalus intermedius voucher BC-ZSM-HYM-01772-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 586 | 87.1% | 535.703 | 3.01e-147 | 86.5% |
| 283 | MH928272 | Encarsia sp. InEnc23 voucher INDOBIOSYS-CCDB25941-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 84.7% | 519.845 | 1.79e-142 | 86.5% |
| 284 | PV031750 | Bruchophagus asphodelinae voucher USNMENT01525844 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 670 | 99.6% | 607.065 | 9.93e-169 | 86.4% |
| 285 | OP498136 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 601.118 | 6.13e-167 | 86.4% |
| 286 | JN293243 | Pteromalidae sp. BBHYK342-10 voucher BIOUG| 648 |
96.3% |
587.242 |
9.21e-163 |
86.4% |
|
| 287 | KR797217 | Chlorocytus sp. BOLD-2016 voucher BIOUG01605-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.4% |
| 288 | KR795994 | Eulophidae sp. BOLD-2016 voucher BIOUG01327-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.4% |
| 289 | KR808820 | Eulophidae sp. BOLD-2016 voucher BIOUG01280-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.4% |
| 290 | MG444411 | Aphelinidae sp. BIOUG23534-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 95.2% | 585.26 | 3.64e-162 | 86.4% |
| 291 | KM997112 | Hymenoptera sp. BOLD:AAG8352 voucher BIOUG00989-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.4% |
| 292 | MF930056 | Aphelinidae sp. BIOUG26624-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 95.2% | 581.295 | 5.68e-161 | 86.4% |
| 293 | HQ106716 | Baryscapus coerulescens voucher EE-29-88 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 620 | 92.1% | 563.455 | 1.33e-155 | 86.4% |
| 294 | KR807454 | Pteromalidae sp. BOLD-2016 voucher BIOUG00997-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 92.6% | 561.473 | 5.27e-155 | 86.4% |
| 295 | HQ106718 | Baryscapus coerulescens voucher EE-26-88 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 617 | 91.7% | 559.49 | 2.08e-154 | 86.4% |
| 296 | HQ106676 | Baryscapus coerulescens voucher EE-18-88 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 617 | 91.7% | 557.508 | 8.22e-154 | 86.4% |
| 297 | OR438294 | Pteromalus sp. voucher 10512MS622022 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 616 | 91.5% | 555.526 | 3.25e-153 | 86.4% |
| 298 | JX832119 | Pteromalidae sp. BOLD:AAG8414 voucher 10PROBE-22009 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 549.579 | 2.00e-151 | 86.4% |
| 299 | KR418158 | Aphelinus sp. BOLD:ACP2973 voucher BIOUG10516-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 600 | 89.2% | 541.65 | 4.88e-149 | 86.4% |
| 300 | KR800623 | Euderus sp. BOLD-2016 voucher BIOUG04324-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 601 | 89.3% | 541.65 | 4.88e-149 | 86.4% |
| 301 | KR792849 | Cecidostiba sp. BOLD-2016 voucher BIOUG12516-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 86.5% | 527.774 | 7.34e-145 | 86.4% |
| 302 | OP498104 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_glabe_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 593.189 | 1.49e-164 | 86.3% |
| 303 | HQ106705 | Baryscapus coerulescens voucher EE-116-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 587.242 | 9.21e-163 | 86.3% |
| 304 | HQ106702 | Baryscapus coerulescens voucher EE-166-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 587.242 | 9.21e-163 | 86.3% |
| 305 | HQ106694 | Baryscapus coerulescens voucher EE-359-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 306 | KR792875 | Sympiesis sericeicornis voucher BIOUG01330-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 307 | MF937214 | Aphelinidae sp. BIOUG26621-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 308 | MF905679 | Eurytomidae sp. BIOUG21119-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 309 | HQ106720 | Baryscapus coerulescens voucher EE-20-88 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 310 | KR793339 | Pteromalidae sp. BOLD-2016 voucher BIOUG01017-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 311 | HQ106706 | Baryscapus coerulescens voucher EE-4-88 P1 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 312 | HQ106691 | Baryscapus coerulescens voucher EE-7088iii-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 313 | MZ626366 | Mesopolobus incultus voucher FCHA-000004 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 585.26 | 3.64e-162 | 86.3% |
| 314 | LC201496 | Hymenoptera sp. P11 mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 650 | 96.6% | 583.277 | 1.44e-161 | 86.3% |
| 315 | HQ106737 | Baryscapus coerulescens voucher EE-64-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 641 | 95.2% | 571.384 | 5.47e-158 | 86.3% |
| 316 | MG505112 | Pteromalidae sp. BIOUG21323-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.2% | 557.508 | 8.22e-154 | 86.3% |
| 317 | MG501818 | Pteromalidae sp. BIOUG21831-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.2% | 553.543 | 1.28e-152 | 86.3% |
| 318 | MF938911 | Aphelinidae sp. BIOUG26620-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.2% | 553.543 | 1.28e-152 | 86.3% |
| 319 | KJ165959 | Aphelinidae sp. BOLD:ACC7642 voucher BIOUG03336-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.2% | 551.561 | 5.07e-152 | 86.3% |
| 320 | KR791285 | Euderus sp. BOLD-2016 voucher BIOUG04552-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 551.561 | 5.07e-152 | 86.3% |
| 321 | MG382118 | Pachyneuron sp. BIOUG24069-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 549.579 | 2.00e-151 | 86.3% |
| 322 | KR414169 | Aphelinus sp. BOLD:ACP2973 voucher BIOUG11213-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 549.579 | 2.00e-151 | 86.3% |
| 323 | MZ633119 | Hymenoptera sp. ZMUO 026949 voucher ZMUO.026949 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 547.597 | 7.92e-151 | 86.3% |
| 324 | MG444705 | Aphelinus sp. BIOUG16026-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 547.597 | 7.92e-151 | 86.3% |
| 325 | MF907131 | Pnigalio maculipes voucher BIOUG21864-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 605 | 89.9% | 541.65 | 4.88e-149 | 86.3% |
| 326 | MG342670 | Pnigalio maculipes voucher BIOUG31032-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 605 | 89.9% | 541.65 | 4.88e-149 | 86.3% |
| 327 | MF938672 | Aphelinidae sp. BIOUG27598-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 88.6% | 533.721 | 1.19e-146 | 86.3% |
| 328 | MF935336 | Aphelinus sp. BIOUG21402-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 584 | 86.8% | 523.81 | 1.15e-143 | 86.3% |
| 329 | PQ375437 | Aphelinus humilis cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 597.153 | 9.56e-166 | 86.2% |
| 330 | OP498160 | Philotrypesis pilosa voucher Phpi_hisp_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 593.189 | 1.49e-164 | 86.2% |
| 331 | OP498135 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 593.189 | 1.49e-164 | 86.2% |
| 332 | KR798810 | Eulophidae sp. BOLD-2016 voucher BIOUG01327-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 577.331 | 8.87e-160 | 86.2% |
| 333 | MG343733 | Pnigalio maculipes voucher BIOUG25748-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 575.348 | 3.50e-159 | 86.2% |
| 334 | KR369414 | Pteromalinae sp. BOLD:ACL2262 voucher BIOUG09870-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.2% | 549.579 | 2.00e-151 | 86.2% |
| 335 | KR793939 | Pteromalidae sp. BOLD-2016 voucher BIOUG01017-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 549.579 | 2.00e-151 | 86.2% |
| 336 | KR795173 | Pteromalidae sp. BOLD-2016 voucher BIOUG01017-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 549.579 | 2.00e-151 | 86.2% |
| 337 | KR890643 | Eulophidae sp. BOLD-2016 voucher BIOUG10632-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 616 | 91.5% | 549.579 | 2.00e-151 | 86.2% |
| 338 | HQ930315 | Eulophidae sp. BBHYH394-10 voucher BIOUG| 614 |
91.2% |
543.632 |
1.24e-149 |
86.2% |
|
| 339 | MG836429 | Neochrysocharis formosa isolate HE21P1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 539.668 | 1.93e-148 | 86.2% |
| 340 | KR367697 | Chlorocytus sp. BOLD:AAM7430 voucher BIOUG10874-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 539.668 | 1.93e-148 | 86.2% |
| 341 | MG499449 | Pachyneuron sp. BIOUG26620-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 594 | 88.3% | 537.685 | 7.62e-148 | 86.2% |
| 342 | KR367295 | Pteromalinae sp. BOLD:ACL2262 voucher BIOUG12100-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 595 | 88.4% | 533.721 | 1.19e-146 | 86.2% |
| 343 | NC_058228 | Anisopteromalus calandrae mitochondrion, complete genome | 673 | 100.0% | 589.224 | 2.33e-163 | 86.1% |
| 344 | OP498105 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_glabe_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 585.26 | 3.64e-162 | 86.1% |
| 345 | OP498103 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_glabe_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 585.26 | 3.64e-162 | 86.1% |
| 346 | OP498134 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 585.26 | 3.64e-162 | 86.1% |
| 347 | OP498163 | Philotrypesis pilosa voucher Phpi_hisp_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 585.26 | 3.64e-162 | 86.1% |
| 348 | OP498132 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 585.26 | 3.64e-162 | 86.1% |
| 349 | MG509606 | Pteromalidae sp. BIOUG20901-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 573.366 | 1.38e-158 | 86.1% |
| 350 | OP443491 | Trichogramma sp. voucher YT-172 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 571.384 | 5.47e-158 | 86.1% |
| 351 | OP443535 | Trichogramma sp. voucher YT-218 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 571.384 | 5.47e-158 | 86.1% |
| 352 | OP443510 | Trichogramma sp. voucher YT-192 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 571.384 | 5.47e-158 | 86.1% |
| 353 | KY837217 | Eulophidae sp. BIOUG02398-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 354 | MZ630264 | Hymenoptera sp. ZMUO 026880 voucher ZMUO.026880 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 355 | MZ630729 | Hymenoptera sp. ZMUO 026950 voucher ZMUO.026950 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 356 | MZ633858 | Hymenoptera sp. ZMUO 026881 voucher ZMUO.026881 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 357 | MZ632439 | Hymenoptera sp. ZMUO 026951 voucher ZMUO.026951 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 358 | MZ632650 | Hymenoptera sp. ZMUO 026953 voucher ZMUO.026953 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 359 | MF907358 | Eulophidae sp. BIOUG14901-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 360 | MZ633353 | Hymenoptera sp. ZMUO 026952 voucher ZMUO.026952 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 361 | MZ629270 | Hymenoptera sp. ZMUO 026956 voucher ZMUO.026956 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.1% |
| 362 | MG836428 | Closterocerus chamaeleon isolate HE17P1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 547.597 | 7.92e-151 | 86.1% |
| 363 | KM558276 | Proctotrupidae sp. BOLD:AAU9262 voucher BIOUG04926-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 91.4% | 537.685 | 7.62e-148 | 86.1% |
| 364 | MH095020 | Eulophidae sp. INDOBIOSYS-CCDB26105-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 537.685 | 7.62e-148 | 86.1% |
| 365 | KM561264 | Pteromalidae sp. BOLD:ACD0516 voucher BIOUG04324-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.0% |
| 366 | MF905552 | Eurytomidae sp. BIOUG15004-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.0% |
| 367 | KM557305 | Pteromalidae sp. BOLD:ACD0516 voucher BIOUG04242-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 569.402 | 2.16e-157 | 86.0% |
| 368 | KY836486 | Eulophidae sp. BIOUG02398-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 563.455 | 1.33e-155 | 86.0% |
| 369 | KM561599 | Pteromalidae sp. BOLD:ACD0516 voucher BIOUG04326-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 549.579 | 2.00e-151 | 86.0% |
| 370 | HM365035 | Closterocerus tau isolate D1568 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 616 | 91.5% | 539.668 | 1.93e-148 | 86.0% |
| 371 | KR370715 | Chlorocytus sp. BOLD:AAM7430 voucher BIOUG10873-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 535.703 | 3.01e-147 | 86.0% |
| 372 | KR790157 | Eulophidae sp. BOLD-2016 voucher BIOUG09924-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 531.739 | 4.70e-146 | 86.0% |
| 373 | MF931204 | Aphelinidae sp. BIOUG27495-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 606 | 90.0% | 531.739 | 4.70e-146 | 86.0% |
| 374 | KM556956 | Pteromalidae sp. BOLD:ACD0516 voucher BIOUG04324-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 608 | 90.3% | 531.739 | 4.70e-146 | 86.0% |
| 375 | MT576113 | Aprostocetus smilax voucher G0046 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 581.295 | 5.68e-161 | 85.9% |
| 376 | OP498162 | Philotrypesis pilosa voucher Phpi_hisp_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 577.331 | 8.87e-160 | 85.9% |
| 377 | OP498147 | Philotrypesis emeryi voucher Phem_micro_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 577.331 | 8.87e-160 | 85.9% |
| 378 | OP498137 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 577.331 | 8.87e-160 | 85.9% |
| 379 | OP498112 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_macle_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 577.331 | 8.87e-160 | 85.9% |
| 380 | JN292309 | Torymidae sp. BBHYI198-10 voucher BIOUG| 652 |
96.9% |
563.455 |
1.33e-155 |
85.9% |
|
| 381 | MG442583 | Eulophidae sp. BIOUG25543-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 561.473 | 5.27e-155 | 85.9% |
| 382 | MZ633602 | Sympiesis sericeicornis voucher ZMUO.026865 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 561.473 | 5.27e-155 | 85.9% |
| 383 | MG498754 | Pachyneuron sp. BIOUG20760-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 561.473 | 5.27e-155 | 85.9% |
| 384 | KP994545 | Trichogramma danaidiphaga voucher CUTD 01-A1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 561.473 | 5.27e-155 | 85.9% |
| 385 | OP443523 | Trichogramma sp. voucher YT-205 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 561.473 | 5.27e-155 | 85.9% |
| 386 | KR879281 | Eulophidae sp. BOLD-2016 voucher BIOUG06650-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 561.473 | 5.27e-155 | 85.9% |
| 387 | MG339895 | Eulophidae sp. BIOUG22031-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 561.473 | 5.27e-155 | 85.9% |
| 388 | MZ629543 | Eulophinae sp. ZMUO 026798 voucher ZMUO.026798 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 559.49 | 2.08e-154 | 85.9% |
| 389 | KR807778 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 559.49 | 2.08e-154 | 85.9% |
| 390 | MZ632695 | Pnigalio longulus voucher ZMUO.027074 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 557.508 | 8.22e-154 | 85.9% |
| 391 | MW784445 | Pnigalio sp. BBP-250 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 557.508 | 8.22e-154 | 85.9% |
| 392 | MZ630591 | Pnigalio longulus voucher ZMUO.027105 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 557.508 | 8.22e-154 | 85.9% |
| 393 | HM365052 | Pnigalio sp. D0255 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 541.65 | 4.88e-149 | 85.9% |
| 394 | KM557931 | Pachyneuron sp. BOLD:ACC8906 voucher BIOUG03548-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 533.721 | 1.19e-146 | 85.9% |
| 395 | MN746318 | Trichogramma chilotraeae isolate TM1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 615 | 91.4% | 529.756 | 1.86e-145 | 85.9% |
| 396 | MN738374 | Trichogramma chilotraeae isolate TNAU 1 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 615 | 91.4% | 529.756 | 1.86e-145 | 85.9% |
| 397 | KT305958 | Trichogramma danaidiphaga voucher CUTD 01-A2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 619 | 92.0% | 529.756 | 1.86e-145 | 85.9% |
| 398 | KR888025 | Eulophidae sp. BOLD-2016 voucher BIOUG12462-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.2% | 529.756 | 1.86e-145 | 85.9% |
| 399 | OP498106 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_glabe_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 569.402 | 2.16e-157 | 85.8% |
| 400 | OP498108 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_macle_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 569.402 | 2.16e-157 | 85.8% |
| 401 | MZ633120 | Sympiesis sericeicornis voucher ZMUO.026883 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 553.543 | 1.28e-152 | 85.8% |
| 402 | KJ207750 | Aphelinidae sp. BOLD:ABA5901 voucher BIOUG03933-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 553.543 | 1.28e-152 | 85.8% |
| 403 | OP292596 | Pleurotroppopsis japonica voucher NK858 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 553.543 | 1.28e-152 | 85.8% |
| 404 | KR789222 | Pnigalio sp. BOLD-2016 voucher BIOUG07707-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 549.579 | 2.00e-151 | 85.8% |
| 405 | OR339873 | Eulophidae sp. voucher SMG 1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 639 | 94.9% | 545.614 | 3.13e-150 | 85.8% |
| 406 | HM365040 | Achrysocharoides sp. D2173 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 631 | 93.8% | 537.685 | 7.62e-148 | 85.8% |
| 407 | HQ107562 | Mesopolobus verditer voucher EE-23-89 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 625 | 92.9% | 531.739 | 4.70e-146 | 85.8% |
| 408 | KM568022 | Proctotrupidae sp. BOLD:AAU9262 voucher 10BBCHY-1694 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 619 | 92.0% | 529.756 | 1.86e-145 | 85.8% |
| 409 | KR801896 | Pteromalidae sp. BOLD-2016 voucher BIOUG17934-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 605 | 89.9% | 527.774 | 7.34e-145 | 85.8% |
| 410 | KY840553 | Eulophidae sp. BIOUG04746-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 525.792 | 2.90e-144 | 85.8% |
| 411 | OP292576 | Elachertus inunctus voucher NK859 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 523.81 | 1.15e-143 | 85.8% |
| 412 | KR806574 | Eulophidae sp. BOLD-2016 voucher 10BBCHY-0841 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 612 | 90.9% | 523.81 | 1.15e-143 | 85.8% |
| 413 | MZ631863 | Chrysocharis sp. ZMUO 027070 voucher ZMUO.027070 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 521.827 | 4.53e-143 | 85.8% |
| 414 | MZ631829 | Achrysocharoides acerianus voucher ZMUO.027063 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 521.827 | 4.53e-143 | 85.8% |
| 415 | KY831124 | Eulophidae sp. BIOUG02400-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 521.827 | 4.53e-143 | 85.8% |
| 416 | KM568978 | Pteromalidae sp. BOLD:ACB7961 voucher BIOUG03717-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 611 | 90.8% | 521.827 | 4.53e-143 | 85.8% |
| 417 | OR976264 | Pteromalus sequester isolate Y47 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.0% | 567.419 | 8.54e-157 | 85.7% |
| 418 | HQ107555 | Mesopolobus verditer voucher EE-40-95 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 557.508 | 8.22e-154 | 85.7% |
| 419 | MG506836 | Pteromalidae sp. BIOUG21220-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 553.543 | 1.28e-152 | 85.7% |
| 420 | OP443497 | Trichogramma sp. voucher YT-179 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 553.543 | 1.28e-152 | 85.7% |
| 421 | OP443468 | Trichogramma sp. voucher YT-239 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 553.543 | 1.28e-152 | 85.7% |
| 422 | KR796564 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 551.561 | 5.07e-152 | 85.7% |
| 423 | JN289082 | Hymenoptera sp. BOLD:AAU8456 voucher BIOUG| 650 |
96.6% |
551.561 |
5.07e-152 |
85.7% |
|
| 424 | KR785272 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 551.561 | 5.07e-152 | 85.7% |
| 425 | GU675365 | Eulophinae sp. BOLD:AAG3133 voucher MTCHA-0036 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 541.65 | 4.88e-149 | 85.7% |
| 426 | KR802660 | Euderus sp. BOLD-2016 voucher BIOUG01330-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 525.792 | 2.90e-144 | 85.7% |
| 427 | KR792605 | Euderus sp. BOLD-2016 voucher BIOUG01330-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 91.4% | 521.827 | 4.53e-143 | 85.7% |
| 428 | OP498146 | Philotrypesis emeryi voucher Phem_micro_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 561.473 | 5.27e-155 | 85.6% |
| 429 | OP498111 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_macle_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 561.473 | 5.27e-155 | 85.6% |
| 430 | MG335732 | Eulophidae sp. BIOUG25477-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 549.579 | 2.00e-151 | 85.6% |
| 431 | KR891474 | Mesopolobus bruchophagi voucher BIOUG07356-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 547.597 | 7.92e-151 | 85.6% |
| 432 | MH928406 | Encarsia citrina voucher INDOBIOSYS-CCDB25940-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 547.597 | 7.92e-151 | 85.6% |
| 433 | OP443500 | Trichogramma sp. voucher YT-182 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 434 | KR786308 | Pteromalidae sp. BOLD-2016 voucher BIOUG01017-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 435 | OP443477 | Trichogramma sp. voucher YT-088 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 436 | OP443546 | Trichogramma sp. voucher YT-230 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 437 | MF956205 | Torymus sp. Genofoveae voucher GDEL3029 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 438 | KP072613 | Hyssopus pallidus voucher M-11-1-1376 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 439 | MG380497 | Torymus sp. BIOUG25593-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 440 | MZ629235 | Sympiesis sericeicornis voucher ZMUO.026818 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 545.614 | 3.13e-150 | 85.6% |
| 441 | KR808851 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 543.632 | 1.24e-149 | 85.6% |
| 442 | KR785777 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 543.632 | 1.24e-149 | 85.6% |
| 443 | KR803438 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 543.632 | 1.24e-149 | 85.6% |
| 444 | KR786320 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 543.632 | 1.24e-149 | 85.6% |
| 445 | KR797119 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 543.632 | 1.24e-149 | 85.6% |
| 446 | KR789464 | Pnigalio sp. BOLD-2016 voucher BIOUG01115-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 541.65 | 4.88e-149 | 85.6% |
| 447 | MZ631330 | Eulophinae sp. ZMUO 026799 voucher ZMUO.026799 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 92.7% | 523.81 | 1.15e-143 | 85.6% |
| 448 | KY836211 | Aphelinidae sp. BIOUG15337-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 92.6% | 521.827 | 4.53e-143 | 85.6% |
| 449 | KR372612 | Pachyneuron sp. BOLD:ACY8582 voucher BIOUG11050-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 519.845 | 1.79e-142 | 85.6% |
| 450 | KR366368 | Pachyneuron sp. BOLD:ACY8582 voucher BIOUG11048-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 91.7% | 519.845 | 1.79e-142 | 85.6% |
| 451 | NC_060368 | Chouioia cunea mitochondrion, complete sequence | 673 | 100.0% | 557.508 | 8.22e-154 | 85.5% |
| 452 | OQ699958 | Pteromalidae sp. isolate KMP228.17 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 99.3% | 555.526 | 3.25e-153 | 85.5% |
| 453 | OP498110 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_macle_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 553.543 | 1.28e-152 | 85.5% |
| 454 | MN671530 | Pteromalidae sp. BOLD:AAZ6757 voucher CHARS00063-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 96.4% | 541.65 | 4.88e-149 | 85.5% |
| 455 | MN683041 | Pteromalus sp. BOLD:AAZ6762 voucher CHARS00261-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 539.668 | 1.93e-148 | 85.5% |
| 456 | MN677420 | Pteromalidae sp. BOLD:AAZ6757 voucher CHARS00103-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 539.668 | 1.93e-148 | 85.5% |
| 457 | JF750718 | Encarsia iris isolate AE618 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 537.685 | 7.62e-148 | 85.5% |
| 458 | MN665401 | Pteromalidae sp. BOLD:AAZ6757 voucher CHARS00229-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 537.685 | 7.62e-148 | 85.5% |
| 459 | KR787801 | Entedoninae sp. BOLD-2016 voucher BIOUG01035-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 537.685 | 7.62e-148 | 85.5% |
| 460 | MN672816 | Pteromalus sp. BOLD:AAZ6762 voucher CHARS00240-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 537.685 | 7.62e-148 | 85.5% |
| 461 | KF444816 | Pnigalio minio isolate OTU004-Pminio-921-F-2004 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 533.721 | 1.19e-146 | 85.5% |
| 462 | MH926549 | Aphelinidae sp. INDOBIOSYS-CCDB25940-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 533.721 | 1.19e-146 | 85.5% |
| 463 | MF906483 | Eulophidae sp. BIOUG21841-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 533.721 | 1.19e-146 | 85.5% |
| 464 | GU675364 | Eulophinae sp. BOLD:AAG3133 voucher MTCHA-0025 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 533.721 | 1.19e-146 | 85.5% |
| 465 | KR801876 | Pnigalio sp. BOLD-2016 voucher BIOUG01115-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 533.721 | 1.19e-146 | 85.5% |
| 466 | PV031746 | Bephratelloides cubensis voucher USNMENT01322048 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.0% | 551.561 | 5.07e-152 | 85.4% |
| 467 | OP498161 | Philotrypesis pilosa voucher Phpi_hisp_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 545.614 | 3.13e-150 | 85.4% |
| 468 | NC_084266 | Anagyrus galinae mitochondrion, complete genome | 666 | 99.0% | 543.632 | 1.24e-149 | 85.4% |
| 469 | KR794372 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 535.703 | 3.01e-147 | 85.4% |
| 470 | MN674120 | Pteromalidae sp. BOLD:AAZ6757 voucher CHARS00059-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.0% | 535.703 | 3.01e-147 | 85.4% |
| 471 | MZ631371 | Achrysocharoides acerianus voucher ZMUO.027066 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 535.703 | 3.01e-147 | 85.4% |
| 472 | KM561410 | Torymus sp. BOLD:ACC8025 voucher BIOUG03656-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 531.739 | 4.70e-146 | 85.4% |
| 473 | GU675351 | Eulophinae sp. BOLD:AAG3133 voucher MTCHA-0102 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 525.792 | 2.90e-144 | 85.4% |
| 474 | PP776024 | Chouioia cunea mitochondrion, partial genome | 673 | 100.0% | 549.579 | 2.00e-151 | 85.3% |
| 475 | KR794565 | Eulophidae sp. BOLD-2016 voucher BIOUG01605-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 531.739 | 4.70e-146 | 85.3% |
| 476 | KY833797 | Eulophidae sp. BIOUG02547-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 531.739 | 4.70e-146 | 85.3% |
| 477 | MN674450 | Pteromalus sp. BOLD:AAZ6762 voucher CHARS00236-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 529.756 | 1.86e-145 | 85.3% |
| 478 | JF750717 | Encarsia iris isolate AE607 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 529.756 | 1.86e-145 | 85.3% |
| 479 | KR792039 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 527.774 | 7.34e-145 | 85.3% |
| 480 | KR806581 | Eulophidae sp. BOLD-2016 voucher BIOUG01657-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 527.774 | 7.34e-145 | 85.3% |
| 481 | KR790856 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 527.774 | 7.34e-145 | 85.3% |
| 482 | KR808153 | Eulophidae sp. BOLD-2016 voucher BIOUG01657-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 527.774 | 7.34e-145 | 85.3% |
| 483 | KR795531 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 527.774 | 7.34e-145 | 85.3% |
| 484 | MF903539 | Eulophidae sp. BIOUG21214-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 525.792 | 2.90e-144 | 85.3% |
| 485 | OP498164 | Philotrypesis tridentata voucher Phtri_benja_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 537.685 | 7.62e-148 | 85.2% |
| 486 | MZ571204 | Eurytoma samsonowi isolate WT_2021 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 659 | 97.9% | 529.756 | 1.86e-145 | 85.2% |
| 487 | MG379140 | Torymus sp. BIOUG24493-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 523.81 | 1.15e-143 | 85.2% |
| 488 | MF901714 | Entedoninae sp. BIOUG20970-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 521.827 | 4.53e-143 | 85.2% |
| 489 | MN667487 | Pteromalus sp. BOLD:AAZ6762 voucher CHARS00236-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 521.827 | 4.53e-143 | 85.2% |
| 490 | KR806787 | Entedoninae sp. BOLD-2016 voucher BIOUG01693-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 521.827 | 4.53e-143 | 85.2% |
| 491 | JF750716 | Encarsia iris isolate AE188 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 521.827 | 4.53e-143 | 85.2% |
| 492 | HQ660515 | Encarsia iris isolate AE193 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 521.827 | 4.53e-143 | 85.2% |
| 493 | KR800083 | Eulophidae sp. BOLD-2016 voucher BIOUG01657-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 519.845 | 1.79e-142 | 85.1% |
| 494 | KR784574 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 519.845 | 1.79e-142 | 85.1% |
| 495 | KR783284 | Eulophidae sp. BOLD-2016 voucher BIOUG01657-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 519.845 | 1.79e-142 | 85.1% |
| 496 | JN289007 | Hymenoptera sp. BOLD:AAU8577 voucher BIOUG| 650 |
96.6% |
519.845 |
1.79e-142 |
85.1% |
|
| 497 | KR794238 | Eulophidae sp. BOLD-2016 voucher BIOUG01572-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 519.845 | 1.79e-142 | 85.1% |
| 498 | MT947602 | Philotrypesis tridentata mitochondrion, partial genome | 673 | 100.0% | 533.721 | 1.19e-146 | 85.0% |
| 499 | JF750719 | Encarsia iris isolate AE613 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 529.756 | 1.86e-145 | 85.0% |
| 500 | JF808723 | Philotrypesis pilosa mitochondrion, partial genome | 665 | 98.8% | 525.792 | 2.90e-144 | 85.0% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Atherigona orientalis | Did not match any candidate |
Database coverage of Taxon of Interest Atherigona orientalisThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Atherigona orientalis
Flag 5.1A:
The reference data supports this taxon well
22 records
There are 22 sequences in the reference database for Atherigona orientalis at the given locus COI.
Global occurrence records for Atherigona orientalis.
Database coverage of species in genus Atherigona
Flag 5.2C:
The reference data offers little support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Atherigona that occur in country of origin Vietnam
Flag 5.3C:
It’s unlikely that the true taxonomic identity is another species in this genus, because no others have been recorded in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI |
||||||||||
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Candidates
Independent sources
Flag 4B:
Reference sequence sources lack diversity and may therefore be unreliable
Reasoning: Matching sequence records for this species have only 1-5 independent sources
(found 1 sources)
1 Independent Source
The matching reference sequences for this species have been annotated by 1 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| OQ134363 | False |
Lee,S. Park,D.-Y. |
Direct Submission | Submitted (27-DEC-2022) Insect Biosystematics Laboratory, Seoul National University, Gwanak-ro 1, Seoul 08826, South Korea |
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |